DNA (deoxyribose nucleic acid) and RNA (ribose nucleic acid) are both nucleotide polymers. These molecules are very similar but there are some distinct differences between them. Both molecules are helical structures but DNA is a double helix whereas RNA is a single helix. DNA is made up of the nucleotides Adenine (A), Thymine (T), Cytosine (C) and Guanine (G). RNA is also made up of A, G and C but T is replaced with Uracil (U). Another distinct nucleotide difference between them is that DNA has one less oxygen on the 5 carbon sugar than RNA; this accounts for the difference in their names. Deoxyribose simply refers to a ribose sugar lacking an oxygen molecule.

Note the lack of one oxygen molecule on the DNA 5 carbon sugar
Perhaps the most important similarity between the two molecules is that they are both essential in protein synthesis. In this lab you will look at the role of DNA and RNA in protein synthesis as process known as DNA Transcription and Translation. In transcription DNA is transcribed into Messenger RNA (mRNA). In translation the mRNA is translated into a polypeptide chain with the aid of Ribosomal RNA (rRNA) and Transfer RNA (tRNA). This polypeptide chain is then folded into a unique protein used in a particular cell function.
Transcription occurs in the cell nucleus where DNA is housed. Think of DNA as instructions to build hardware (proteins), unfortunately, these instructions are in another language and incomprehensible to the workers that will eventually assemble the hardware. This is where mRNA will come into the picture - to provide new instructions that will be used by the workers. In transcription DNA is unzipped and the enzyme RNA polymerase runs along the template strand of the DNA. The template strand of DNA can be identified by finding the nucleotide sequence T A C at the 3’ end (If the strand is written backwards it may look like C A T at the 3’ end). This identifies that strand as the template and the other strand, the information strand, will not be used in this transcription (this does not mean, however, that it may not be used in future transcription processes). As the RNA polymerase runs along the DNA template strand it will add the complementary RNA nucleotides to the DNA nucleotides. This means that G will be paired with C, and visa versa, and A (DNA) will be paired with U (RNA - rather than T in DNA replication) and T (DNA) paired with A (RNA). When the single helix mRNA strand is complete it will separate from the DNA and the DNA will re-zip into the double helix.

An artistic representation of transcription
In eukaryotes, once the mRNA is transcribed it will then be processed. A cap and tail will be added to the ends of the mRNA strand. Then the strand will be spliced. The introns (non-coding regions) will be removed and the remaining exons (coding regions) will be spliced together. The completed mRNA strand has groups of three nucleotides known as codons (for example, A U G is the codon in mRNA that was transcribed from T A C). These groups of three will code for a particular amino acid in translation (A U G will code for the start amino acid, methionine, in translation).

mRNA Splicing
Translation occurs when the mRNA strand moves out of the nucleus and into the cytoplasm. At this point mRNA, rRNA and tRNA all come together. The rRNA consists of two parts, the large ribosomal unit and the small ribosomal unit. On the large ribosomal unit are two sites- the A site and the P site. These will be the sites of polypeptide synthesis and elongation. The rRNA is like the factory of translation and if rRNA is the factory than tRNA is the worker. The tRNA molecules have an amino acid (the monomer of proteins) attachment site and it also carries an anticodon. The anticodon is the complementary nucleotide sequence to a given codon. The tRNA will pick up the appropriate amino acid in the cytoplasm that is coded for by the mRNA codon that its anticodon matches. Think of it as a lock and key process.

tRNA
In translation the mRNA will run through the rRNA from the 5’ end (with A U G) to the terminating codon at the 3’ end. The first codon, A U G, will start in the A site. There, the tRNA with the appropriate anticodon, U A C, will meet up with the start codon bringing with it the appropriate amino acid, methionine.

An example of an mRNA codon chart used to determine amino acids
Once this is complete, the complex will move over to the P site. The next codon will move in, connect with its tRNA and appropriate amino acid. The two amino acids in the rRNA will then form a peptide bond. At this point, The first tRNA will disconnect from its U A C amino acid and go back into the cytoplasm. The second tRNA with the small, elongating polypeptide attached will move into the P site. The third codon will enter the rRNA and the process will happen again as before. This will continue in assembly-line fashion with the polypeptide chain elongating all the time until a stop or terminating codon enters the A site. At this point the translation will stop and the completed polypeptide chain will disconnect to be folded into a complete protein. The rRNA will float off to be used in other translations and the mRNA in other transcriptions.

The Steps of DNA Translation
Although this process is very straightforward and simple, mistakes are made. A mutation is a mistake made during DNA replication where a nucleotide is incorrectly replaced, added or omitted. These mistakes do not happen very often and when they do, often have no discernable effect on the organism. But occasionally, they can have devastating effects. There are many different types of mutations, three types of mutations include insertions (the addition of an extra nucleotide), deletion (the deletion of a nucleotide) and substitution (the incorrect placement of a nucleotide). Any of these mistakes can result in an incorrect mRNA strand and more importantly, an incorrect polypeptide chain. If the polypeptide chain is changed enough then the resulting protein may not function correctly. For example, sickle cell anemia, a devastating blood disease is a result of one base pair substitution. This small mutation has a large scale effect. Many substitutions, however, may have no effect at all.
3' ACGTCAGACAATCCGAAGGTAGGC 5'
5' TGCAGTCTGTTAGGCTTCCATCCG 3'1. Determine which is the template strand and which is the information strand.
2. What is the mRNA molecule?
3. What is the polypeptide sequence?
4. What are the anticodons for the tRNA?
- Where is mRNA produced and what is the process called?
- tRNA carries amino acids to ribosomes where the amino acids are joined to form
a polypeptide. Where does this occur and what is the process called?
- A triplet of 3 bases of tRNA is called a/an _________________.
- A triplet of 3 bases of mRNA is called a/an ___________________.
- Suppose an error in transcription occurs such that an incorrect amino acid is
put where the amino acid arginine should be. Which amino acid is most
likely to be incorrectly placed? Why?
- Explain what is meant when we say that the DNA code is redundant, but not
ambiguous.
- The synthesis of proteins based on an mRNA template is called _____________
and occurs within the ____________ of the cell.
- The synthesis of mRNA from DNA is called _______________ and occurs within the
______________ of the cell.
- The protein and rRNA structure that assists in transcription is called a
_______________.
- What two things are attached to tRNA?
- What is a transversion mutation?
- What is a transtition mutation?